Cox6b2 (NM_001289849) Mouse Untagged Clone

CAT#: MC225571

Cox6b2 (untagged) - Mouse cytochrome c oxidase subunit VIb polypeptide 2 (Cox6b2), transcript variant 4


  "NM_001289849" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cox6b2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cox6b2
Synonyms 1700067P11Rik; BC048670; COXVIB2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225571 representing NM_001289849
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTGGGTGTTCAAGCCCAGAAGCCCCCTCCGGGCCAATGGACAACGCCGCCCTTTGATCCGCGCTTCC
CTAACCAGAACCAGACGCGTAACTGCTACCAGAATTTTCTGGACTACCACCGGTGTGTGAAGACCATGAA
TCGCCGCGGAAAGAGCACACAACCCTGCGAGTGCAGCGCTGGAATGAGCAGATCAAGCAGGGAACTTTCC
CGGGCAAAATATGACCTTGCACTTGAGCGCTGCTCCCCTGGCGTCATCAACCCCTAG


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001289849
ORF Size 267 bp
Insert Size 267
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001289849.1, NP_001276778.1
RefSeq Size 525
RefSeq ORF 267
Locus ID 333182

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.