Scgb3a2 (NM_001289644) Mouse Untagged Clone

CAT#: MC225587

Scgb3a2 (untagged) - Mouse secretoglobin, family 3A, member 2 (Scgb3a2), transcript variant 2


  "NM_001289644" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Scgb3a2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Scgb3a2
Synonyms LuLeu1; Pnsp1; UGRP1; Utgrp1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225587 representing NM_001289644
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCTGGTATCTATCTTTCTGCTGGTGACCATTGGTATTTGTGGTTATTCTGCCACTGCCCTTCTCA
TCAACCGTCTCCCTGTTGTTGACAAATTACCTGTACCTTTGGACGACATTATTCCCTCATTTGATCCCTT
GAAGATGCTTCTGAAAACCCTGGGCATTTCTGTAGAACATCTGGTGACAGGACTGAAGAAGTGTGTGGAC
GAGCTGGGACCAGAGGCTTCCGAGGCCGTGAAGAAGCTTCTGGAGGCTCTTTCACACCTGGTATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289644
ORF Size 276 bp
Insert Size 276
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001289644.1, NP_001276573.1
RefSeq Size 549
RefSeq ORF 276
Locus ID 117158

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.