Fxyd1 (NM_194321) Mouse Untagged Clone
CAT#: MC225590
Fxyd1 (untagged) - Mouse FXYD domain-containing ion transport regulator 1 (Fxyd1), transcript variant 4
"NM_194321" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Fxyd1 |
Synonyms | 0610012C17Rik; 1110006M24Rik; Plm; Pml |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225590 representing NM_194321
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCATCTCCCGGCCACATCCTGGCTCTGTGTGTGTGTCTCCTCTCCATGGCCAGTGCAGAAGCTCCAC AGGAACCGGATCCATTCACCTACGATTACCACACCCTGCGGATCGGCGGCCTCACTATCGCTGGGATCCT CTTCATCTTGGGCATCCTTATCATCCTTAGCAAGAGATGTCGATGCAAATTCAACCAACAGCAGAGAACT GGGGAACCCGACGAAGAGGAGGGAACTTTCCGCAGCTCCATCCGCCGTCTGTCATCCCGCAGGCGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_194321 |
ORF Size | 279 bp |
Insert Size | 279 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This clone expresses the complete ORF with c-terminal tags of Myc-DDK. |
Reference Data | |
RefSeq | NM_194321.2, NP_919302.1 |
RefSeq Size | 631 |
RefSeq ORF | 279 |
Locus ID | 56188 |
Gene Summary | This gene encodes a member of the FXYD family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The protein encoded by this gene is a plasma membrane substrate for several kinases, including protein kinase A, protein kinase C, NIMA kinase, and myotonic dystrophy kinase. It is thought to form an ion channel or regulate ion channel activity and act as an accessory protein of Na,K-ATPase. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Variants 3, 4 and 5 encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227801 | Fxyd1 (myc-DDK-tagged) - Mouse FXYD domain-containing ion transport regulator 1 (Fxyd1), transcript variant 4 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review