Spink2 (NM_001289764) Mouse Untagged Clone

CAT#: MC225591

Spink2 (untagged) - Mouse serine peptidase inhibitor, Kazal type 2 (Spink2), transcript variant 1


  "NM_001289764" in other vectors (1)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Spink2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Spink2
Synonyms 1700007F22Rik; AV038945; HUSI-II
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225591 representing NM_001289764
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTTCGTGCCGTGCCGTTACTGGCGGTTCTGCCCCGTGGAGAGTGGTGGCCATGGAAGCCTCTCATG
AGACTCTCGACTCTTCCGATTCTCAAATCATGAAGAGGTCACAGTTCCGAACACCAGACTGTGGTCATTT
TGACTTCCCAGCATGCCCTAGGAACCTCAACCCTGTGTGCGGAACGGATATGAACACTTACAGCAATGAA
TGTACCCTGTGCATGAAAATCAGGGAGGACGGTAGCCATATTAATATCATCAAAGACGAGCCATGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289764
ORF Size 279 bp
Insert Size 279
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001289764.1, NP_001276693.1
RefSeq Size 552
RefSeq ORF 279
Locus ID 69982

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.