Crabp1 (NM_001284507) Mouse Untagged Clone

CAT#: MC225620

Crabp1 (untagged) - Mouse cellular retinoic acid binding protein I (Crabp1), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Crabp1
• Synonyms: AI326249; Crabp-1; CRABP-I; CrabpI; Rbp-5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225620 representing NM_001284507
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCCAACTTCGCCGGTACCTGGAAGATGCGCAGCAGCGAGAATTTCGACGAGCTCCTCAAGGCGTTGG
  GTGTGAACGCCATGCTGAGGAAGGTGGCCGTGGCGGCTGCGTCTAAGCCGCACGTGGAGATCCGCCAAGA
  CGGGGATCAGTTCTACATCAAGACATCCACTACTGTGCGCACCACGGAGATCAACTTCAAGGTCGGAGAG
  GGCTTCGAGGAGGAGACAGTGGACGGACGCAAATGCAGGACATTTGGCGCCGATGATGTGGTGTGCACAA
  GAATTTATGTCCGGGAGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001284507
• ORF Size: 300 bp
• Insert Size: 300
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001284507.1, NP_001271436.1
• RefSeq Size: 688
• RefSeq ORF: 300
• Locus ID: 12903
• Gene Summary: Cytosolic CRABPs may regulate the access of retinoic acid to the nuclear retinoic acid receptors. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks an in-frame exon in the coding region compared to variant 1. The encoded protein (isoform 2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.