Apoc3 (NM_001289756) Mouse Untagged Clone

CAT#: MC225621

Apoc3 (untagged) - Mouse apolipoprotein C-III (Apoc3), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Apoc3
• Synonyms: apo-CIII; apoC-III
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225621 representing NM_001289756
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCAGCCCCGGACGCTCCTCACTGTGGCCCTCTTGGCTCTCCTGGCATCTGCCCGAGCTGAAGAGGTAG
  AGGGATCCTTGCTGCTGGGCTCTGTACAGGGCTACATGGAACAAGCCTCCAAGACGGTCCAGGATGCGCT
  AAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATCCCTG
  AAAGGCTACTGGAGCAAGTTTACTGACAAGTTCACCGGCTTCTGGGATTCTAACCCTGAGGACCAACCAA
  CTCCAGCTATTGAGTCGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289756
• ORF Size: 300 bp
• Insert Size: 300
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001289756.1, NP_001276685.1
• RefSeq Size: 601
• RefSeq ORF: 300
• Locus ID: 11814
• Gene Summary: This gene encodes an apolipoprotein which is the major protein component of very-low-density lipoproteins (VLDL) and a minor component of high-density lipoproteins (HDL). The encoded protein is thought to regulate the metabolism of triglyceride-rich lipoproteins and play a role in lipid storage and the mobilization of fat cells. This gene is clustered with three other apolipoprotein genes on chromosome 9 and is associated with coronary disease. Mice lacking this gene have lower levels of total cholesterol in the plasma. Mutations in the human genes causes hyperalphalipoproteinemia 2, a disorder of lipid metabolism which results in a favorable lipid profile (lower LDL-cholesterol, higher HDL-cholesterol and lower levels of serum triglycerides when fasting and after a meal). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
  Transcript Variant: This variant (2) represents the use of an alternate promoter, differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (b) has a shorter N-terminus compared to isoform a. Variants 2 and 3 encode the same protein.