Vamp5 (NM_001080742) Mouse Untagged Clone

CAT#: MC225631

Vamp5 (untagged) - Mouse vesicle-associated membrane protein 5 (Vamp5), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Vamp5
• Synonyms: AF119384; Camp
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225631 representing NM_001080742
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCAGGGAAAGAACTGAAGCAATGCCAGCAGCAGGCGGACGAAGTGACGGAAATCATGCTCAACAATT
  TCGACAAGGTCCTGGAGCGTCACGGCAAGCTGGCGGAGTTGGAGCAGCGTTCAGACCAGCTCCTGGACAT
  GAGTTCGGCCTTCAGCAAGACAACCAAGACTTTAGCCCAGCAGAAGCGCTGGGAAAATATCCGGTGCCGG
  GTCTACTTGGGGCTAGCAGTGGCTGTTGGCCTGCTCATCATCCTGATTGTGTTGCTGGTCGTCTTTCTTC
  CGAGTGGTGGGGACAGTAGTAAACCATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001080742
• ORF Size: 309 bp
• Insert Size: 309
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001080742.2, NP_001074211.1
• RefSeq Size: 1538
• RefSeq ORF: 309
• Locus ID: 53620
• Gene Summary: May participate in trafficking events that are associated with myogenesis, such as myoblast fusion and/or GLUT4 trafficking. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.