Vamp5 (NM_001080742) Mouse Untagged Clone

CAT#: MC225631

Vamp5 (untagged) - Mouse vesicle-associated membrane protein 5 (Vamp5), transcript variant 2


  "NM_001080742" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Vamp5"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Vamp5
Synonyms AF119384; Camp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225631 representing NM_001080742
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGGGAAAGAACTGAAGCAATGCCAGCAGCAGGCGGACGAAGTGACGGAAATCATGCTCAACAATT
TCGACAAGGTCCTGGAGCGTCACGGCAAGCTGGCGGAGTTGGAGCAGCGTTCAGACCAGCTCCTGGACAT
GAGTTCGGCCTTCAGCAAGACAACCAAGACTTTAGCCCAGCAGAAGCGCTGGGAAAATATCCGGTGCCGG
GTCTACTTGGGGCTAGCAGTGGCTGTTGGCCTGCTCATCATCCTGATTGTGTTGCTGGTCGTCTTTCTTC
CGAGTGGTGGGGACAGTAGTAAACCATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001080742
ORF Size 309 bp
Insert Size 309
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001080742.2, NP_001074211.1
RefSeq Size 1538
RefSeq ORF 309
Locus ID 53620
Gene Summary May participate in trafficking events that are associated with myogenesis, such as myoblast fusion and/or GLUT4 trafficking. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.