Fkbp1a (NM_001302080) Mouse Untagged Clone

CAT#: MC225639

Fkbp1a (untagged) - Mouse FK506 binding protein 1a (Fkbp1a), transcript variant 6


  "NM_001302080" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Fkbp1a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fkbp1a
Synonyms Fkbp; Fkbp1; FKBP12
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225639 representing NM_001302080
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGGAATATTGAAATACATCTTGGCAAGAACAGACTCTTCTCATGGACCAAATCGCAGTAGCTGTT
GTGGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCTCGGGACAGAAACAAGCCTTTTAAGTTTACACT
AGGCAAGCAGGAGGTGATCCGAGGCTGGGAGGAAGGGGTAGCCCAGATGAGTGTGGGTCAGAGAGCCAAA
CTGATAATCTCCTCAGACTATGCCTATGGAGCCACCGGGCACCCAGGCATCATCCCACCACATGCCACTC
TTGTTTTTGATGTGGAGCTTCTAAAACTGGAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302080
ORF Size 315 bp
Insert Size 315
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001302080.1, NP_001289009.1
RefSeq Size 1791
RefSeq ORF 315
Locus ID 14225
Gene Summary This gene is a member of the immunophilin family. The encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin, and is associated with immunoregulation, protein folding, receptor signaling, protein trafficking and T-cell activation. It may modulate the calcium release activity of the ryanodine receptor Ryr1. It also interacts with the type I TGF-beta receptor. Disruption of this gene in mouse causes severe ventricular defects. Pseudogenes of this gene have been defined on chromosomes 4, 10, 14, and 16. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (6) contains an alternate exon in the 5' region, uses an alternate start codon, and differs in the 3' UTR compared to variant 1. It encodes isoform 3 which has a distinct N-terminus and is shorter than isoform 1. Variants 5 and 6 both encode the same isoform (3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.