Fkbp1a (NM_001302080) Mouse Untagged Clone

CAT#: MC225639

Fkbp1a (untagged) - Mouse FK506 binding protein 1a (Fkbp1a), transcript variant 6

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fkbp1a
• Synonyms: Fkbp; Fkbp1; FKBP12
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225639 representing NM_001302080
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAAGGAATATTGAAATACATCTTGGCAAGAACAGACTCTTCTCATGGACCAAATCGCAGTAGCTGTT
  GTGGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCTCGGGACAGAAACAAGCCTTTTAAGTTTACACT
  AGGCAAGCAGGAGGTGATCCGAGGCTGGGAGGAAGGGGTAGCCCAGATGAGTGTGGGTCAGAGAGCCAAA
  CTGATAATCTCCTCAGACTATGCCTATGGAGCCACCGGGCACCCAGGCATCATCCCACCACATGCCACTC
  TTGTTTTTGATGTGGAGCTTCTAAAACTGGAATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302080
• ORF Size: 315 bp
• Insert Size: 315
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001302080.1, NP_001289009.1
• RefSeq Size: 1791
• RefSeq ORF: 315
• Locus ID: 14225
• Gene Summary: This gene is a member of the immunophilin family. The encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin, and is associated with immunoregulation, protein folding, receptor signaling, protein trafficking and T-cell activation. It may modulate the calcium release activity of the ryanodine receptor Ryr1. It also interacts with the type I TGF-beta receptor. Disruption of this gene in mouse causes severe ventricular defects. Pseudogenes of this gene have been defined on chromosomes 4, 10, 14, and 16. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (6) contains an alternate exon in the 5' region, uses an alternate start codon, and differs in the 3' UTR compared to variant 1. It encodes isoform 3 which has a distinct N-terminus and is shorter than isoform 1. Variants 5 and 6 both encode the same isoform (3).