Dynlrb1 (NM_001291108) Mouse Untagged Clone

CAT#: MC225640

Dynlrb1 (untagged) - Mouse dynein light chain roadblock-type 1 (Dynlrb1), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dynlrb1
• Synonyms: 2010012N15Rik; 2010320M17Rik; 9430076K19Rik; AV124457; Dncl2a; DNLC2A; km23-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225640 representing NM_001291108
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCTTTCCTCCTCCGCTCTGGGAAGCAGAGGTGGAGGAAACACTCAAGAGGCTTCAGAGCCAGAAAG
  GAGTGCAGGGCATCATCGTGGTGAACACAGAAGGCATTCCCATCAAGAGCACAATGGACAATCCCACCAC
  TACACAGTATGCCAACCTCATGCACAACTTCATCTTGAAGGCGCGGAGCACTGTGCGTGAGATTGACCCC
  CAAAACGACCTAACCTTCCTTCGAATTCGCTCCAAGAAAAATGAAATTATGGTGGCACCAGATAAAGACT
  ATTTCCTGATTGTGATCCAGAATCCAACTGAATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291108
• ORF Size: 315 bp
• Insert Size: 315
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001291108.1, NP_001278037.1
• RefSeq Size: 946
• RefSeq ORF: 315
• Locus ID: 67068
• Gene Summary: Acts as one of several non-catalytic accessory components of the cytoplasmic dynein 1 complex that are thought to be involved in linking dynein to cargos and to adapter proteins that regulate dynein function. Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) encodes the longer isoform (a).