Sigmar1 (NM_001286551) Mouse Untagged Clone

CAT#: MC225657

Sigmar1 (untagged) - Mouse sigma non-opioid intracellular receptor 1 (Sigmar1), transcript variant 7

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Sigmar1
• Synonyms: Oprs1; Sig1R; sigma1R
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225657 representing NM_001286551
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCGTGGGCCGCGGGACGGCGGTGGGCATGGATCACCCTGATTCTGACTATTATCGCAGTGCTGATCC
  AGGCCGCCTGGTTGTGGCTGGGCACTCAAAACTTCGTCTTCTCTAGAGAAGAAATAGCGCAGCTTGCTCG
  ACAGTATGCGGGGCTGGACCATGAGCTTGCCTTCTCTCGGCTGATCGTGGAGCTGCGGAGGCTGCACCCA
  GGCCACGTGCTGCCGGATGAGGAGCTGCAGTGGGTATTTGTGAACGCGGGCGGCTGGATGGGCGCCATGT
  GTATTCTGCACGCCTCGCTGTCTGAGACGATACTGGGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286551
• ORF Size: 321 bp
• Insert Size: 321
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001286551.1, NP_001273480.1
• RefSeq Size: 1593
• RefSeq ORF: 321
• Locus ID: 18391
• Gene Summary: This gene encodes a transmembrane protein located in the endoplasmic reticulum. The encoded protein is a receptor that binds several endogenous ligands, including N,N-dimethyltryptamine, progesterone and pregnenolone and a variety of of non-opiate compounds. The encoded protein plays a role in regulating the activity of ion channels, acting as a chaperone and protecting cells from oxidative stress. In humans, this receptor has been associated with Alzheimer's and Parkinson's diseases, stroke and numerous disease conditions such as depression, pain and addiction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
  Transcript Variant: This variant (7) differs in the 3' UTR and uses an alternate splice site in the coding region which results in a frameshift compared to variant 1. The encoded protein (isoform 7; also known as short form sigma1R) is shorter and has a distinct C-terminus compared to isoform 1. This isoform negatively regulates the function of the longest isoform (1) by forming a complex with the latter (PMID 22619170). Variants 7 and 8 encode the same protein.