Hoxd8 (NM_001290731) Mouse Untagged Clone

CAT#: MC225661

Hoxd8 (untagged) - Mouse homeobox D8 (Hoxd8), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hoxd8
• Synonyms: 4921540P06Rik; AI047735; Hox-4.3; Hox-5.4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225661 representing NM_001290731
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTTCCCTGGATGAGACCACAAGCAGCTCCTGGTAGACGGAGAGGAAGACAAACCTACAGTCGCTTCC
  AAACCCTAGAGTTGGAAAAGGAATTCCTTTTTAACCCTTATCTGACCAGGAAGAGGAGAATCGAGGTCTC
  CCATACTCTGGCCCTCACGGAGAGACAGGTAAAAATCTGGTTCCAGAACAGGAGAATGAAATGGAAAAAG
  GAGAACAACAAAGACAAGTTTCCTGCGTCCCGGCCGGAGGCAAAGGATGGAGACCCCAAAAAGGAAGTCT
  CGGGGCTGGAAGAAGACGGAGCTGAAGGCTGCCCCACAAATTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001290731
• ORF Size: 324 bp
• Insert Size: 324
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001290731.1, NP_001277660.1
• RefSeq Size: 1683
• RefSeq ORF: 324
• Locus ID: 15437
• Gene Summary: Sequence-specific transcription factor which is part of a developmental regulatory system that provides cells with specific positional identities on the anterior-posterior axis. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) contains an alternate 5' terminal exon, and it thus differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.