D3Ertd751e (NM_001291048) Mouse Untagged Clone

CAT#: MC225669

D3Ertd751e (untagged) - Mouse DNA segment, Chr 3, ERATO Doi 751, expressed (D3Ertd751e), transcript variant 4


  "NM_001291048" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "D3Ertd751e"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol D3Ertd751e
Synonyms 2810009O15Rik; 4930415G15Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225669 representing NM_001291048
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATTTTAAAATCGAATACACTTGGGATGGTTTCCCAGTGAGACATGAGCCAGTGTGTGTCAGGCTGA
GTCCGTGTGAGCAGGGAGTGAAGATGGAGGTTAGTGCTCCATTATTCAATGATCCTCCATCCCCTCTCGG
AGAACCAGGAAAGCCTTTCAGTGAACTGTGGAATTATGAAGTTGTGGAAGCATTTTTTTTGAATGATACA
ACTAAGCAGTATTTAGAAGTCGAACTTTGTCCCCATCGTCTAGAATATTTCAAGCCTTTCAGTTTCAACA
CACTGCTTGGAGAAGAATGGAGGCAGCCAGAACCAGACCTGTGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291048
ORF Size 327 bp
Insert Size 327
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001291048.1, NP_001277977.1
RefSeq Size 1052
RefSeq ORF 327
Locus ID 73852

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.