Atp5j (NM_001302213) Mouse Untagged Clone

CAT#: MC225670

Atp5j (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F (Atp5j), transcript variant 1


  "NM_001302213" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Atp5j"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Atp5j
Synonyms Atp5pf; CF6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225670 representing NM_001302213
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTTCTGCAGAGGATCTTCAGGCTCTCCTCTGTCCTTCGGTCAGCAGTCTCTGTGCATTTGAAGAGGA
ACATTGGTGTTACAGCTGTGGCCTTTAATAAGGAACTTGATCCTGTACAGAAACTCTTCGTGGACAAGAT
AAGAGAGTACAAATCAAAGCGACAGGCATCTGGAGGACCTGTTGATATTGGCCCAGAGTATCAGCAAGAT
CTGGACAGAGAGCTTTATAAGCTTAAACAAATGTATGGTAAAGGAGAGATGGATACATTTCCTACCTTCA
AATTTGATGATCCCAAATTTGAAGTCATCGACAAACCCCAGTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302213
ORF Size 327 bp
Insert Size 327
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001302213.1, NP_001289142.1
RefSeq Size 875
RefSeq ORF 327
Locus ID 11957
Gene Summary The protein encoded by this gene is a component of mitochondrial adenosine triphosphate synthase, which catalyzes the conversion of ATP from ADP. Mitochondrial adenosine triphosphate synthase consists of extrinsic and intrinsic membrane domains that are joined by a stalk. The protein encoded by this gene is a subunit of the stalk domain. A bi-directional promoter that drives expression of this gene has been has been identified. Pseudogenes of this gene are found on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, 3, 4, 5, 6 and 7 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.