Gzmm (NM_001302499) Mouse Untagged Clone

CAT#: MC225685

Gzmm (untagged) - Mouse granzyme M (lymphocyte met-ase 1) (Gzmm), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gzmm
• Synonyms: Lmet1; MMET-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225685 representing NM_001302499
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGACCCACCAGGGTGGGCCCCGGGCCAGGGCCCTGCAGGAGTTGGATCTGCGTGTGCTGGATACCCAAA
  TGTGTAACAACAGCCGCTTCTGGAACGGTGTCCTCATAGACAGCATGCTATGCTTAAAGGCTGGGAGCAA
  GAGCCAAGCCCCCTGCAAGGGTGACTCTGGAGGGCCCCTGGTGTGTGGCAAAGGCCAGGTGGATGGGATC
  CTGTCTTTCAGCTCCAAAACCTGCACAGACATCTTCAAGCCACCTGTGGCCACTGCTGTAGCCCCCTACA
  GCTCCTGGATCAGGAAGGTCATTGGTCGCTGGTCACCCCAATCTTTGGTCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302499
• ORF Size: 333 bp
• Insert Size: 333
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001302499.1, NP_001289428.1
• RefSeq Size: 815
• RefSeq ORF: 333
• Locus ID: 16904
• Gene Summary: The protein encoded by this gene is a member of a family of cytotoxic lymphocyte serine proteases called granzymes, which are expressed by cytotoxic T lymphocytes and natural killer cells. This protein belongs to a subfamily of granzymes that cleave after methionine residues. Natural killer cell development, homeostasis and cytotoxicity are normal in mice deficient for this gene, but they demonstrate increased susceptibility to murine cytomegalovirus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (3) contains a distinct 5' UTR, lacks exons in the coding region, and utilizes a downstream start codon compared to variant 1. It encodes isoform 3, which is shorter than isoform 1.