Retn (NM_001204959) Mouse Untagged Clone

CAT#: MC225701

Retn (untagged) - Mouse resistin (Retn), transcript variant 2


  "NM_001204959" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Retn"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Retn
Synonyms ADSF; Fizz3; Rstn; Xcp4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225701 representing NM_001204959
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGAACCTTTCATTTCCCCTCCTTTTCCTTTTCTTCCTTGTCCCTGAACTGCTGGGCTCCAGCATGC
CACTGTGTCCCATCGATGAAGCCATCGACAAGAAGATCAAACAAGACTTCAACTCCCTGTTTCCAAATGC
AATAAAGAACATTGGCTTAAATTGCTGGACAGTCTCCTCCAGAGGGAAGTTGGCCTCCTGCCCAGAAGGC
ACAGCAGTCTTGAGCTGCTCCTGTGGCTCTGCCTGTGGCTCGTGGGACATTCGTGAAGAAAAAGTGTGTC
ACTGCCAGTGTGCAAGGATAGACTGGACAGCAGCCCGCTGCTGTAAGCTGCAGGTCGCTTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001204959
ORF Size 345 bp
Insert Size 345
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001204959.1, NP_001191888.1
RefSeq Size 607
RefSeq ORF 345
Locus ID 57264
Gene Summary Hormone that seems to suppress insulin ability to stimulate glucose uptake into adipose cells. Potentially links obesity to diabetes. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.