H2afb3 (NM_001281531) Mouse Untagged Clone

CAT#: MC225706

H2afb3 (untagged) - Mouse H2A histone family, member B3 (H2afb3)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: H2afb3
• Synonyms: EG624957; H2A.Bbd3; H2afb3-ps
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225706 representing NM_001281531
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCAAGGAACAGGGAAAACTGTCTTCGAGAGTCTTCAGGTCGCCGCCACCGTCGCTCCCGCACCTCCA
  GAGCTGAGCTAATCTTTGCTGTGAGCCTGGTGGAACAGCATCTGAGGGAGGTTAGCCGTGCCCGGAGGCT
  CAGTGATACGGTGCCCATCTTCCTGGCAGCCATCCTGGAGTCCCTCACCCGCAGGTTGCTGGAGCTTGCC
  GGCAATGAGGCCCAACGCAGAGGTACCGAGAGGCGCATCACTCCTGAACTGCTGGACTTGGCTGTCTACA
  GCAATATGGAGCTAAGTGATGTGTTCCAATTCATCACCATCTCCCAGGTGGCCCCGGCTCATCGCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001281531
• ORF Size: 348 bp
• Insert Size: 348
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001281531.2, NP_001268460.1
• RefSeq Size: 645
• RefSeq ORF: 348
• Locus ID: 624957
• Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. [provided by RefSeq, Nov 2015]