Tac2 (NM_001199971) Mouse Untagged Clone

CAT#: MC225712

Tac2 (untagged) - Mouse tachykinin 2 (Tac2), transcript variant 2


  "NM_001199971" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Tac2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tac2
Synonyms PPT-B; Tac3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225712 representing NM_001199971
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGAGCGCCATGCTGTTTGCGGCTGTCCTCGCCCTCAGCTTGGCTTGGACCTTCGGGGCTGTGTGTG
AGGAGCCACAGGGGCAGGGAGGGAGGCTCAGTAAGGACTCTGATCTCTATCAGCTGCCTCCGTCCCTGCT
TCGGAGACTCTACGACAGCCGCCCTGTCTCTCTGGAAGGATTGCTGAAAGTGCTGAGCAAGGCTAGCGTG
GGACCAAAGGAGACATCACTTCCACAGAAACGTGACATGCACGACTTCTTTGTGGGACTTATGGGCAAGA
GGAACAGCCAACCAGACACTCCCACCGACGTGGTTGAAGAGAACACCCCCAGCTTTGGCATCCTCAAATA
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001199971
ORF Size 351 bp
Insert Size 351
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001199971.1, NP_001186900.1
RefSeq Size 870
RefSeq ORF 351
Locus ID 21334
Gene Summary This gene encodes a member of the tachykinin family of signaling peptides that is widely expressed in the central nervous system and plays a role in diverse processes such as water homeostasis, pulmonary inflammation, cognition, fear memory consolidation and preeclampsia. The encoded protein is enzymatically processed to generate the mature neuropeptide. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.