Tac2 (NM_001199971) Mouse Untagged Clone

CAT#: MC225712

Tac2 (untagged) - Mouse tachykinin 2 (Tac2), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tac2
• Synonyms: PPT-B; Tac3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225712 representing NM_001199971
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGGAGCGCCATGCTGTTTGCGGCTGTCCTCGCCCTCAGCTTGGCTTGGACCTTCGGGGCTGTGTGTG
  AGGAGCCACAGGGGCAGGGAGGGAGGCTCAGTAAGGACTCTGATCTCTATCAGCTGCCTCCGTCCCTGCT
  TCGGAGACTCTACGACAGCCGCCCTGTCTCTCTGGAAGGATTGCTGAAAGTGCTGAGCAAGGCTAGCGTG
  GGACCAAAGGAGACATCACTTCCACAGAAACGTGACATGCACGACTTCTTTGTGGGACTTATGGGCAAGA
  GGAACAGCCAACCAGACACTCCCACCGACGTGGTTGAAGAGAACACCCCCAGCTTTGGCATCCTCAAATA
  A
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199971
• ORF Size: 351 bp
• Insert Size: 351
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001199971.1, NP_001186900.1
• RefSeq Size: 870
• RefSeq ORF: 351
• Locus ID: 21334
• Gene Summary: This gene encodes a member of the tachykinin family of signaling peptides that is widely expressed in the central nervous system and plays a role in diverse processes such as water homeostasis, pulmonary inflammation, cognition, fear memory consolidation and preeclampsia. The encoded protein is enzymatically processed to generate the mature neuropeptide. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.