Selenoh (NM_001037279) Mouse Untagged Clone
CAT#: MC225713
2700094K13Rik (untagged) - Mouse RIKEN cDNA 2700094K13 gene (2700094K13Rik), transcript variant 2
"NM_001037279" in other vectors (2)
Product Images
Other products for "Selenoh"
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Selenoh |
Synonyms | 2700094K13Rik; Selh |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225713 representing NM_001037279
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCCCCCACGGAAGAAAGCGTAAGGCGGGGGCCGCGCCTATGGAGACGGTGGACAAGCGCGAGAAAC TGGCGGAGGGCGCGACCGTGGTCATTGAGCATTGTACGAGCTGACGCGTGTACGGCCGCCATGCTGCTGC CTTGAGCCAGGCTCTGCAACTGGAGGCCCCAGAGCTACCTGTGCAAGTGAACCCGTCCAAACCGCGGAGG GGCAGCTTCGAGGTGACGCTGCTGCGCTCGGACAACAGCCGTGTTGAACTCTGGACTGGTATTAAGAAGG GCCCTCCACGAAAGCTCAAATTTCCTGAGCCTCAAGAGGTGGTTGAAGAATTGAAGAAGTACCTTTCATA A AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001037279 |
Insert Size | 351 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This clone expresses the complete ORF with c-terminal tags of Myc-DDK. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001037279.2, NP_001032356.1 |
RefSeq Size | 669 bp |
RefSeq ORF | 351 bp |
Locus ID | 72657 |
Cytogenetics | 2 D |
Gene Summary | This gene encodes a nucleolar protein, which belongs to the SelWTH family. It functions as an oxidoreductase, and has been shown to protect neurons against UVB-induced damage by inhibiting apoptotic cell death pathways, promote mitochondrial biogenesis and mitochondrial function, and suppress cellular senescence through genome maintenance and redox regulation. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2016] Transcript Variant: This variant (2) uses an alternate donor splice site at the penultimate exon in the 3' non-coding region compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.