Nppb (NM_001287348) Mouse Untagged Clone

CAT#: MC225738

Nppb (untagged) - Mouse natriuretic peptide type B (Nppb), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Nppb
• Synonyms: AA408272; BNF; BNP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225738 representing NM_001287348
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGATCTCCTGAAGGTGCTGTCCCAGATGATTCTGTTTCTGCTTTTCCTTTATCTGTCACCGCTGGGAG
  GTCACTCCTATCCTCTGGGAAGTCCTAGCCAGTCTCCAGAGCAATTCAAGATGCAGCTGCTGGAGCTGAT
  AAGAGAAAAGTCGGAGGAAATGGCCCAGAGACAGCTCTTGAAGGACCAAGGCCTCACAAAAGAACACCCA
  AAAAGAGTCCTTCGGTCTCAAGGCAGCACCCTCCGGGTCCAGCAGAGACCTCAAAATTCCAAGGTGACAC
  ATATCTCAAGCTGCTTTGGGCACAAGATAGACCGGATCGGATCCGTCAGTCGTTTGGGCTGTAACGCACT
  GAAGTTGTTGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001287348
• ORF Size: 363 bp
• Insert Size: 363
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001287348.1, NP_001274277.1
• RefSeq Size: 778
• RefSeq ORF: 363
• Locus ID: 18158
• Gene Summary: This gene encodes a secreted protein that belongs to the family of natriuretic peptides. Its precursor protein is processed to generate the active mature peptide. The mature peptide is a cardiac hormone that plays a role in ventricular remodeling as well as blood pressure regulation. Mice lacking this gene exhibit cardiac fibrosis. In humans this gene is associated with congestive heart failure, low bone-mineral density and postmenopausal osteoporosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2013]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. The encoded protein (isoform 2, also known as Short isoform) is shorter than isoform 1.