Bsph1 (NM_001301682) Mouse Untagged Clone

CAT#: MC225761

Bsph1 (untagged) - Mouse binder of sperm protein homolog 1 (Bsph1), transcript variant 2


  "NM_001301682" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Bsph1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Bsph1
Synonyms Gm767
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225761 representing NM_001301682
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCAGCCTTTGGATTTTCTATTGGTTTCAATCTGCCTGTTTCACAGCCTTTTCAGTTTTCAAGTAG
AAGATTATTATGCACCAACTATAGATGGTGCATGTGTCTTTCCGTTCTTGTATAGAAGTGAAATATTCTA
TGACTGTGTCAATTTCAATCTGAAACACAAGTGGTGTTCTTTGAACAAGACTTACCAAGGTTACTGGAAA
TACTGTGCTCTTTCAGACTATGCTCCATGTGCCTTTCCCTTCTGGTACAGACATATGATCTACTGGGATT
GCACAGAGGATGGAGAGGTGTTTGGGAAAAAGTGGTGTTCACTCACCCCAAATTACAACAAAGACCAAGT
TTGGAAATATTGTATAGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301682
ORF Size 372 bp
Insert Size 372
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001301682.1, NP_001288611.1
RefSeq Size 793
RefSeq ORF 372
Locus ID 330470
Gene Summary This gene encodes a member of the binder of sperm family. The encoded protein may be involved in sperm capacitation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region compared to variant 1. It encodes isoform 2 which is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.