Mpdu1 (NM_001301711) Mouse Untagged Clone

CAT#: MC225778

Mpdu1 (untagged) - Mouse mannose-P-dolichol utilization defect 1 (Mpdu1), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mpdu1
• Synonyms: LEC35; SL15; Supl15h
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225778 representing NM_001301711
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCACTACAGAGGAGAGACCGTGAAAGGAGTCGCTTTCCTTGCCTGCTATGCCATGGTCCTGCTGGCGC
  TGCTCTCCCCGCTCACGCCTCTGGCTGTAGTCACTCTGCTCCAGGCCTCCAATGTACCTGCCGTGGTGGT
  GGGGAAGTTGCTTCAGGCAGCCACTAACTACCGCAACGGACACACAGGCCAGCTTTCAGCCATTACAGTG
  TTTATGCTGTTTGGGGGCTCCTTGGCCCGAATCTTCACTTCTGTTCAGGAAACTGGAGACCCCCTCATGG
  CTGGAGTCTTTGTGGTCTCTTCTCTCTGCAATGGCCTCATTGCTGCCCAGGTCCTCTTCTACTGGAACGC
  AAAGGCTCCCCACAAACAGAAAAAGGAGCAATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301711
• ORF Size: 384 bp
• Insert Size: 384
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001301711.1, NP_001288640.1
• RefSeq Size: 1363
• RefSeq ORF: 384
• Locus ID: 24070
• Gene Summary: This gene encodes a member of the PQ-loop superfamily. A similar gene in human encodes a protein that is required for monosaccharide-P-dolichol-dependent glycosyltransferase reactions, and disruption of this gene is the cause of congenital disorder of glycosylation (CDG) type 1F, a disease linked to defects in protein N-glycosylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (3) uses an alternate splice site and uses an in-frame downstream start codon, compared to variant 1. The resulting protein (isoform 3) has a shorter N-terminus than isoform 1.