Agrp (NM_001271806) Mouse Untagged Clone

CAT#: MC225807

Agrp (untagged) - Mouse agouti related protein (Agrp), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Agrp
• Synonyms: Agrt; Art
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225807 representing NM_001271806
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGACTGCAATGTTGCTGAGTTGTGTTCTGCTGTTGGCACTGCCTCCCACACTGGGGGTCCAGATGG
  GCGTGGCTCCACTGAAGGGCATCAGAAGGCCTGACCAGGCTCTGTTCCCAGAGTTCCCAGGTCTAAGTCT
  GAATGGCCTCAAGAAGACAACTGCAGACCGAGCAGAAGAAGTTCTGCTGCAGAAGGCAGAAGCTTTGGCG
  GAGGTGCTAGATCCACAGAACCGCGAGTCTCGTTCTCCGCGTCGCTGTGTAAGGCTGCACGAGTCCTGCT
  TGGGACAGCAGGTACCTTGCTGCGACCCGTGCGCTACGTGCTACTGCCGCTTCTTCAATGCCTTTTGCTA
  CTGCCGCAAGCTGGGTACGGCCACGAACCTCTGTAGTCGCACCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271806
• ORF Size: 396 bp
• Insert Size: 396
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001271806.1, NP_001258735.1
• RefSeq Size: 777
• RefSeq ORF: 396
• Locus ID: 11604
• Gene Summary: This gene encodes a protein that regulates feeding behavior and plays a key role in the control of body weight. The encoded protein acts as an antagonist of melanocortin receptor signaling. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Nov 2012]
  Transcript Variant: This variant (2) contains an alternate 5' exon, compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.