Nmb (NM_001291280) Mouse Untagged Clone

CAT#: MC225810

Nmb (untagged) - Mouse neuromedin B (Nmb), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Nmb
• Synonyms: 3110023K12Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225810 representing NM_001291280
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGACCCGGCAAGCAGGGAGCTCTTGGCTCCTCCGTGGTCTCCTGCTCTTCGCATTGTTCGCTTCCGGCG
  TCGCTCCCTTCAACTGGGATCTCCCGGAGCCCCGCAGCCGAGCAAGCAAGATTCGAGTGCACCCTCGGGG
  CAACCTCTGGGCGACCGGTCACTTCATGGGCAAGAAGAGCCTGGAACCCCCGAGCCTGTCACTGGTGGGG
  ACAGCACCCCCTAACACCCCGAGGGACCAGAGACTACAGCTGAGTCATGATCTGCTCAGGATCCTCCTGC
  GAAAGAAAGCTCTAGGCATGAACTTCAGTGGCCCAGCTCCCCCAATCCAGGAGGCTGCTGGAGCCACTAC
  TGCAGAAGTGATGCCAATAATGGAACAAACCGGATGCTGGGCTTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291280
• ORF Size: 396 bp
• Insert Size: 396
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001291280.1, NP_001278209.1
• RefSeq Size: 687
• RefSeq ORF: 396
• Locus ID: 68039
• Gene Summary: This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in satiety, reproduction and thermoregulation, as well as in stress, fear and other behavioral responses. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2016]
  Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.