Csn1s2b (NM_001301335) Mouse Untagged Clone

CAT#: MC225819

Csn1s2b (untagged) - Mouse casein alpha s2-like B (Csn1s2b), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Csn1s2b
• Synonyms: AW987150; Csnd; Csne
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225819 representing NM_001301335
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGTTCATCATTCTTACTTGCCTTTTGGCCGTTGCTCTTGCAAAGCAGAGGATGGAGCAATACATCT
  CCAGTGAGGAGTCCATGGATAACTCTCAAGAAAACTTTAAGCAGAATATGGATGTGGCCTTTTTTCCCAG
  TCAGGAATCTGTTGAAGCTCCCATGAAGGTATCTGACATCATTTCTCAGCAACAATACAACCAGAAAATG
  ATGGACATGAGTGTGAGTGCCAGAGAGAAAACTGTGATGACTGAAGAAAGTAAGAACATCCAAGACTACA
  TGAACAAAATGAAACGATACAGCAAGATCACCTGGCCACAGTTTGTAAAGCTTCTCCATCAATACCAGAA
  AACCATGACCCCGTGGAGCTATTACCCATCTACCCCCAGCCAGGTTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301335
• ORF Size: 399 bp
• Insert Size: 399
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001301335.1, NP_001288264.1
• RefSeq Size: 733
• RefSeq ORF: 399
• Locus ID: 12992
• Gene Summary: This gene is a member of the alpha-s2-like casein gene family, and this gene product is a calcium-sensitive casein. Members of this gene family are organized as a gene cluster that is conserved in its order, but with greater conservation amongst orthologs than paralogs. The protein encoded by this gene interacts with other casein proteins to form a micelle structure, and is a major source of protein in milk. This structure is important for the transport of calcium, phosphate, and protein. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
  Transcript Variant: This variant (3) lacks an in-frame exon, compared to variant 1. It encodes isoform 3 which is shorter than isoform 1.