Fabp5 (NM_001272097) Mouse Untagged Clone

CAT#: MC225837

Fabp5 (untagged) - Mouse fatty acid binding protein 5, epidermal (Fabp5), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fabp5
• Synonyms: E-FABP; Fabpe; Klbp; mal1; PA-FABP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225837 representing NM_001272097
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCAGTCTTAAGGATCTCGAAGGGAAGTGGCGCCTGATGGAAAGCCACGGCTTTGAGGAGTACATGA
  AAGAGCTAGGAGTAGGACTGGCTCTTAGGAAGATGGCTGCCATGGCCAAGCCAGACTGTATCATTACGTG
  TGATGGCAACAACATCACGGTCAAAACCGAGAGCACAGTGAAGACGACTGTGTTCTCTTGTAACCTGGGA
  GAGAAGTTTGATGAAACGACAGCTGATGGCAGAAAAACTGAGACGGTCTGCACCTTCCAAGACGGTGCCC
  TGGTCCAGCACCAGCAATGGGACGGGAAGGAGAGCACGATAACAAGAAAACTGAAGGATGGGAAGATGAT
  CGTGTGTGTCATGAACAATGCCACCTGCACTCGGGTCTATGAGAAGGTGCAATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001272097
• ORF Size: 405 bp
• Insert Size: 405
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001272097.1, NP_001259026.1
• RefSeq Size: 950
• RefSeq ORF: 405
• Locus ID: 16592
• Gene Summary: The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. In humans this gene has been associated with psoriasis and type 2 diabetes. In mouse deficiency of this gene in combination with a deficiency in Fabp4 confers protection against atherosclerosis, diet-induced obesity, insulin resistance and experimental autoimmune encephalomyelitis (the mouse model for multiple sclerosis). Alternative splicing results in multiple transcript variants that encode different protein isoforms. The mouse genome contains many pseudogenes similar to this locus. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (2) uses an alternate in-frame acceptor splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (by one amino acid; isoform 2), compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.