Mdk (NM_001012335) Mouse Untagged Clone

CAT#: MC225868

Mdk (untagged) - Mouse midkine (Mdk), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mdk
• Synonyms: Mek; MK
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225868 representing NM_001012335
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCAGCACCGAGGCTTCTTCCTTCTCGCCCTTCTTGCCCTCTTGGTGGTCACGTCCGCGGTGGCCAAAA
  AAAAAGAGAAGGTGAAGAAGGGCAGCGAGTGTTCGGAGTGGACCTGGGGGCCCTGCACCCCCAGCAGCAA
  GGACTGCGGCATGGGCTTCCGCGAGGGTACCTGTGGGGCCCAGACCCAGCGCGTCCATTGCAAGGTGCCC
  TGCAACTGGAAGAAGGAATTTGGAGCCGACTGCAAATACAAGTTTGAGAGCTGGGGGGCGTGTGATGGGA
  GCACTGGCACCAAAGCCCGCCAAGGGACCCTGAAGAAGGCGCGGTACAATGCCCAGTGCCAGGAGACCAT
  CCGCGTGACTAAGCCCTGCACCTCCAAGACCAAGTCAAAGACCAAAGCCAAGAAAGGAAAAGGAAAGGAC
  TAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001012335
• Insert Size: 423 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001012335.2, NP_001012335.1
• RefSeq Size: 878 bp
• RefSeq ORF: 423 bp
• Locus ID: 17242
• Cytogenetics: 2 50.63 cM
• Gene Summary: This gene encodes a secreted growth factor that belongs to the pleiotrophin/midkine heparin-binding protein family and functions in a variety of biological processes. The encoded cytokine promotes the growth, differentiation, survival and migration of several target cells including leucocytes involved in inflammation. This protein plays a role in the formation of scar tissue and intraperitoneal adhesions, and promotes neurite outgrowth and neuron survival. The protein encoded by this gene is associated with obesity and inhibition of insulin signaling in fat cells. A pseudogene of this gene is present on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 through 4 encode the same isoform (a).