Mdk (NM_001291481) Mouse Untagged Clone

CAT#: MC225869

Mdk (untagged) - Mouse midkine (Mdk), transcript variant 4


  "NM_001291481" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mdk
Synonyms Mek; MK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225869 representing NM_001291481
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGCACCGAGGCTTCTTCCTTCTCGCCCTTCTTGCCCTCTTGGTGGTCACGTCCGCGGTGGCCAAAA
AAAAAGAGAAGGTGAAGAAGGGCAGCGAGTGTTCGGAGTGGACCTGGGGGCCCTGCACCCCCAGCAGCAA
GGACTGCGGCATGGGCTTCCGCGAGGGTACCTGTGGGGCCCAGACCCAGCGCGTCCATTGCAAGGTGCCC
TGCAACTGGAAGAAGGAATTTGGAGCCGACTGCAAATACAAGTTTGAGAGCTGGGGGGCGTGTGATGGGA
GCACTGGCACCAAAGCCCGCCAAGGGACCCTGAAGAAGGCGCGGTACAATGCCCAGTGCCAGGAGACCAT
CCGCGTGACTAAGCCCTGCACCTCCAAGACCAAGTCAAAGACCAAAGCCAAGAAAGGAAAAGGAAAGGAC
TAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291481
ORF Size 423 bp
Insert Size 423
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001291481.1, NP_001278410.1
RefSeq Size 785
RefSeq ORF 423
Locus ID 17242
Gene Summary This gene encodes a secreted growth factor that belongs to the pleiotrophin/midkine heparin-binding protein family and functions in a variety of biological processes. The encoded cytokine promotes the growth, differentiation, survival and migration of several target cells including leucocytes involved in inflammation. This protein plays a role in the formation of scar tissue and intraperitoneal adhesions, and promotes neurite outgrowth and neuron survival. The protein encoded by this gene is associated with obesity and inhibition of insulin signaling in fat cells. A pseudogene of this gene is present on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1 through 4 encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.