Elk3 (NM_001282967) Mouse Untagged Clone

CAT#: MC225883

Elk3 (untagged) - Mouse ELK3, member of ETS oncogene family (Elk3), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Elk3
• Synonyms: D430049E23Rik; Erp; Etrp; Net; Sap-2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225883 representing NM_001282967
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGAGTGCAATCACGCTGTGGCAGTTCCTCTTGCACTTGCTGCTGGACCAGAAACATGAGCACCTCA
  TCTGCTGGACATCGAACGATGGCGAGTTCAAGCTCCTCAAGGCGGAAGAAGTGGCCAAGCTGTGGGGCCT
  CCGCAAGAACAAGACCAACATGAACTACGACAAGCTGAGCAGAGCGCTGAGATACTATTACGACAAGACA
  CCAAGTGGACTGTTTCTGGCCTCGAGTCCGCTGCTGCCCAGCATACACTTCTGGAGCAGCCTTAGTCCTG
  TCGCCCCACTGAGTCCTGCCAGGCTGCAAGGGCCGAACACACTTTTCCAGTTCCCCACACTGCTCAACGG
  TCACATGCCGGTGCCGCTCCCCAGTCTGGACAGAGCTCCATCCCCAGTTCTGCTGTCCCCCAGCTCTCAG
  AAATCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282967
• ORF Size: 429 bp
• Insert Size: 429
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001282967.1, NP_001269896.1
• RefSeq Size: 3433
• RefSeq ORF: 429
• Locus ID: 13713
• Gene Summary: May be a negative regulator of transcription, but can activate transcription when coexpressed with Ras, Src or Mos. Forms a ternary complex with the serum response factor and the ETS and SRF motifs of the Fos serum response element. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) lacks exon 3, but maintains the reading frame compared to variant 1. The resulting isoform (Elk3d) lacks an internal protein segment compared to isoform Elk3. Unlike isoform Elk3, this isoform is predominantly localized in the cytosol and has been shown to activate transcription (PMID:20304071). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.