Zfp740 (NM_001289694) Mouse Untagged Clone

CAT#: MC225895

Zfp740 (untagged) - Mouse zinc finger protein 740 (Zfp740), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Zfp740
• Synonyms: 1110034O07Rik; AW548228; Znf740
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225895 representing NM_001289694
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATGCTGAGCCAGATTGCCAGCAAGCAGGCTGAAAACGGCGAGCGGGCAGGTAGCCCTGATGTGCTGA
  GGTGCTCCAGTCAGATGGACTGTAAGCCTAGATTTGATTTGTCTTCAAAGGGCCACCGAAAAGACAGTGA
  TAAATCCCGCAACCGCAAAGAGGATGACAGCTTGGCTGAGGCCTCTCATTCAAAAAAGACTGTTAAAAAG
  GTGAGAAACCATTTGAGTGTGATGTCTGTGATATGCGTTTCATCCAGAAGTACCATCTCGAACGCCACAA
  GCGGGTACACAGTGGCGAAAAGCCTTACCAGTGTGAACGATGTCATCAGTGTTTTTCTCGGACAGACCGA
  TTACTCAGACACAAACGGATGTGCCAAGGATGCCAGTCCAAGACTTCTGAAGGGCAGTTTTCTCTATAGG
  CACAAGGGGCCCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289694
• ORF Size: 435 bp
• Insert Size: 435
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001289694.1, NP_001276623.1
• RefSeq Size: 3958
• RefSeq ORF: 435
• Locus ID: 68744
• Gene Summary: May be involved in transcriptional regulation. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in both UTR's and has multiple coding region differences one of which results in a frameshift compared to variant 1. These differences also cause translation initiation at a downstream start codon compared to variant 1. This results in an isoform (3) that is shorter at the N-terminus and has a distinct C-termini, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.