Ndufv2 (NM_001278415) Mouse Untagged Clone

CAT#: MC225940

Ndufv2 (untagged) - Mouse NADH dehydrogenase (ubiquinone) flavoprotein 2 (Ndufv2), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ndufv2
• Synonyms: 2900010C23Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225940 representing NM_001278415
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAACAAGGTGGCTGAAGTTTTACAAGTACCTCCAATGAGAGTATATGAAGTAGCAACTTTTTATACAA
  TGTATAATCGAAAGCCAGTTGGGAAGTACCATATCCAGGTCTGCACTACTACACCTTGCATGCTGCGAGA
  TTCTGACAGCATATTGGAGACCCTTCAGAGAAAGCTTGGAATAAAGGTTGGAGAGACTACACCTGACAAA
  CTTTTCACTCTTATAGAAGTGGAATGTTTAGGGGCCTGTGTAAATGCACCGATGGTTCAAATAAATGACA
  ACTACTATGAGGATCTGACACCCAAGGATATTGAAGAGATTATTGATGAACTCAAAGCTGGAAAAGTTCC
  CAAACCAGGGCCAAGGAGTGGCCGCTTCTGTTGTGAGCCAGCTGGAGGCCTTACTTCTTTGACTGAACCA
  CCCAAAGGACCTGGCTTTGGTGTGCAAGCAGGCCTTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278415
• ORF Size: 459 bp
• Insert Size: 459
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001278415.1, NP_001265344.1
• RefSeq Size: 1637
• RefSeq ORF: 459
• Locus ID: 72900
• Gene Summary: This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. This gene is a core subunit and is conserved in prokaryotes and eukaryotes. The bovine ortholog of this protein has been characterized and is reported to contain an iron-sulfur cluster, which may be involved in electron transfer. In humans mutations in this gene are implicated in Parkinson's disease, bipolar disorder, schizophrenia, and have been found in one case of early onset hypertrophic cardiomyopathy and encephalopathy. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
  Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region and uses a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.