Tph1 (NM_001276372) Mouse Untagged Clone

CAT#: MC225965

Tph1 (untagged) - Mouse tryptophan hydroxylase 1 (Tph1), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tph1
• Synonyms: Tph
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225965 representing NM_001276372
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATTGAAGACAACAAGGAGAACAAAGAGAACAAAGACCATTCCTCCGAAAGAGGGAGAGTGACTCTCA
  TCTTCTCCTTGGAGAATGAAGTCGGAGGACTCATAAAAGTGCTGAAAATCTTCCAGGAGAATCATGTGAG
  CCTGTTACACATCGAGTCCCGGAAATCAAAGCAAAGAAATTCAGAATTTGAGATATTTGTTGACTGCGAC
  ATCAGCCGAGAACAGTTGAATGACATCTTCCCCCTGCTGAAGTCGCACGCCACCGTCCTCTCGGTGGACT
  CGCCCGATCAGCTCACTGCGAAGGAAGACGTTATGGAGACTGTCCCTTGGTTTCCAAAGAAGATTTCTGA
  CCTGGACTTCTGCGCCAACAGAGTGCTGTTGTATGGATCCGAACTTGACGCCGACCACCCTGTAAATATG
  TTTACAAAGTCACGCAGTGCGAATAACTTAAGTCAAACTGAAGATTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276372
• ORF Size: 468 bp
• Insert Size: 468
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001276372.1, NP_001263301.1
• RefSeq Size: 628
• RefSeq ORF: 468
• Locus ID: 21990
• Gene Summary: This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase family. The encoded protein is one of two tryptophan hydroxylase enzymes that catalyze the first and rate limiting step in the biosynthesis of the hormone and neurotransmitter, serotonin. This gene is expressed in peripheral organs, while tryptophan hydroxylase 2 is expressed in neurons. The encoded protein is involved in the development of hypoxia-induced elevations in pulmonary pressures and pulmonary vascular remodeling, and has also been implicated as a regulator of immune tolerance. Disruption of this gene is associated with cardiac dysfunction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
  Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.