Tph1 (NM_001276372) Mouse Untagged Clone

CAT#: MC225965

Tph1 (untagged) - Mouse tryptophan hydroxylase 1 (Tph1), transcript variant 3


  "NM_001276372" in other vectors (1)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Tph1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tph1
Synonyms Tph
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225965 representing NM_001276372
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATTGAAGACAACAAGGAGAACAAAGAGAACAAAGACCATTCCTCCGAAAGAGGGAGAGTGACTCTCA
TCTTCTCCTTGGAGAATGAAGTCGGAGGACTCATAAAAGTGCTGAAAATCTTCCAGGAGAATCATGTGAG
CCTGTTACACATCGAGTCCCGGAAATCAAAGCAAAGAAATTCAGAATTTGAGATATTTGTTGACTGCGAC
ATCAGCCGAGAACAGTTGAATGACATCTTCCCCCTGCTGAAGTCGCACGCCACCGTCCTCTCGGTGGACT
CGCCCGATCAGCTCACTGCGAAGGAAGACGTTATGGAGACTGTCCCTTGGTTTCCAAAGAAGATTTCTGA
CCTGGACTTCTGCGCCAACAGAGTGCTGTTGTATGGATCCGAACTTGACGCCGACCACCCTGTAAATATG
TTTACAAAGTCACGCAGTGCGAATAACTTAAGTCAAACTGAAGATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001276372
ORF Size 468 bp
Insert Size 468
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001276372.1, NP_001263301.1
RefSeq Size 628
RefSeq ORF 468
Locus ID 21990
Gene Summary This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase family. The encoded protein is one of two tryptophan hydroxylase enzymes that catalyze the first and rate limiting step in the biosynthesis of the hormone and neurotransmitter, serotonin. This gene is expressed in peripheral organs, while tryptophan hydroxylase 2 is expressed in neurons. The encoded protein is involved in the development of hypoxia-induced elevations in pulmonary pressures and pulmonary vascular remodeling, and has also been implicated as a regulator of immune tolerance. Disruption of this gene is associated with cardiac dysfunction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.