Plpp2 (NM_001302390) Mouse Untagged Clone

CAT#: MC225982

Ppap2c (untagged) - Mouse phosphatidic acid phosphatase type 2C (Ppap2c), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Plpp2
• Synonyms: Lpp2; PAP2-G; PAP2-gamma; PAP2c; Ppap2c
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225982 representing NM_001302390
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATTGGCCGTCTTCGACCCAGTTTCTTGGCTGTCTGTGACCCTGACTGGAGCCAGGTCAACTGTTCTG
  GCTATGTGCAGCTGGAGGTGTGCAGGGGCAGCCCTGCTAATGTCACGGAGGCCAGGCTGTCCTTCTACTC
  TGGCCACTCCTCCTTTGGCATGTATTGCATGTTGTTCCTGGCGCTATATGTGCAGGCCCGGCTCTGCTGG
  AAGTGGGCACGGCTGCTGAGGCCCACTGTTCAGTTCTTCTTGGTGGCCTTTGCAATCTATGTGGGCTATA
  CCCGAGTGTCTGACCACAAGCACCACTGGAGTGATGTCCTTGTCGGCCTCCTGCAGGGAGCCCTGGTGGC
  CTGCCTCACGGTCCGCTATGTTTCAGATTTCTTCAAATCCCGGCCACCCCAGCCCTGCCAGGAGGATGAA
  GTGCCGGAGCGCAAGCCCAGTCTGTCACTGACGCTGACCCTTGGTGACCGACCCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302390
• ORF Size: 477 bp
• Insert Size: 477
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001302390.1, NP_001289319.1
• RefSeq Size: 1499
• RefSeq ORF: 477
• Locus ID: 50784
• Gene Summary: The protein encoded by this gene is a lipid phosphate phosphohydrolase. It is an integral membrane protein that catalyzes the conversion of phosphatidic acid to diacylglycerol and inorganic phosphate. The transcript is expressed at high levels in lung, liver, and kidney and at low levels in brain and heart. Null mutant mice are viable and fertile and display no overt phenotypic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (3) differs in the 5' UTR and lacks an exon in the 5' coding region, which results in use of a downstream start codon compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1.