Avpr2 (NM_001276299) Mouse Untagged Clone

CAT#: MC225993

Avpr2 (untagged) - Mouse arginine vasopressin receptor 2 (Avpr2), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Avpr2
• Synonyms: ADHR; DI1; DIR; ND1; V2R; VPV2R
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225993 representing NM_001276299
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATCCTGGTGTCTACCACGTCTGGCATTGCTGCCTGCCAGGTTCTTATCTTCCGGGAGATACATGCCA
  GTCTGGTGCCAGGGCCATCTGAAAGGGCAGGGAGGCGCCGCAGAGGACACCGGACAGGAAGTCCCAGCGA
  GGGAGCCCATGTATCAGCAGCCATGGCCAAGACCGTGAGGATGACACTGGTGATTGTGATTGTCTACGTG
  CTGTGCTGGGCACCCTTCTTCCTTGTGCAGCTGTGGGCAGCGTGGGATCCAGAAGCTCCTCTGGAAAGAC
  CCCCCTTTGTGTTGCTCATGCTGCTGGCTAGCCTTAACAGCTGTACCAACCCCTGGATCTATGCTTCCTT
  CAGTAGCAGTGTCTCCTCGGAGTTGCGTAGCCTGCTTTGCTGTGCTCAGAGGCACACCACACACAGCCTG
  GGTCCTCAAGATGAGTCCTGTGCCACAGCCAGCTCCTCTCTGATGAAGGATACACCCTCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276299
• ORF Size: 483 bp
• Insert Size: 483
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001276299.1, NP_001263228.1
• RefSeq Size: 1179
• RefSeq ORF: 483
• Locus ID: 12000
• Gene Summary: This gene encodes a member of the G-protein coupled receptor 1 family and the vasopressin/oxytocin receptor subfamily. The encoded protein is an arginine vasopressin receptor which, when stimulated, activates the Gs protein/adenylyl cyclase signaling cascade and is involved in water and electrolyte homeostasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (3) uses an alternate in-frame splice site in the coding region, compared to variant 1. It encodes a shorter protein (isoform c) compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.