Bad (NM_001285453) Mouse Untagged Clone

CAT#: MC226010

Bad (untagged) - Mouse BCL2-associated agonist of cell death (Bad), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Bad
• Synonyms: AI325008; Bbc2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226010 representing NM_001285453
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTCCAGATCCCAGAGTTTGAGCCGAGTGAGCAGGAAGACGCTAGTGCTACAGATAGGGGCCTGGGCC
  CTAGCCTCACTGAGGACCAGCCAGGTCCCTACCTGGCCCCAGGTCTCCTGGGGAGCAACATTCATCAGCA
  GGGACGGGCAGCCACCAACAGTCATCATGGAGGCGCAGGGGCTATGGAGACTCGGAGTCGCCACAGTTCG
  TACCCAGCGGGGACCGAGGAGGATGAAGGGATGGAGGAGGAGCTTAGCCCTTTTCGAGGACGCTCGCGTT
  CGGCTCCCCCCAATCTCTGGGCAGCGCAGCGCTACGGCCGTGAGCTCCGAAGGATGAGCGATGAGTTTGA
  GGGTTCCTTCAAGGGACTTCCTCGCCCAAAGAGCGCAGGCACTGCAACACAGATGCGACAAAGCGCCGGC
  TGGACGCGCATTATCCAGTCCTGGTGGGATCGAAACTTGGGCAAAGGAGGCTCCACCCCCTCCCAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001285453
• ORF Size: 489 bp
• Insert Size: 489
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001285453.1, NP_001272382.1
• RefSeq Size: 941
• RefSeq ORF: 489
• Locus ID: 12015
• Gene Summary: Promotes cell death. Successfully competes for the binding to Bcl-X(L), Bcl-2 and Bcl-W, thereby affecting the level of heterodimerization of these proteins with BAX. Can reverse the death repressor activity of Bcl-X(L), but not that of Bcl-2. Appears to act as a link between growth factor receptor signaling and the apoptotic pathways. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.