Scamp5 (NM_001301635) Mouse Untagged Clone

CAT#: MC226026

Scamp5 (untagged) - Mouse secretory carrier membrane protein 5 (Scamp5), transcript variant 3


  "NM_001301635" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Scamp5"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Scamp5
Synonyms Sc5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226026 representing NM_001301635
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTTCTACCAAGACTTCGAGGCAGACATCCCTCCTCAGCATCTCAGCTTGACCAAGCGCCTCTACTAC
CTCTGGATGTGACAGACAGTTCCTTCAGCTTCATGGCATTCTTCTTCACCTTCATGGCTCAGCTGGTCAT
CAGCATCATCCAGGCTGTGGGAATTCCAGGCTGGGGTGTCTGCGGCTGGATTGCCACCATTTCCTTCTTC
GGGACGAACATCGGCTCAGCAGTGGTGATGCTCATTCCCACGGTCATGTTCACAGTTGTGGCCGTCTTTT
CCTTCATTGCTCTTAGCATGGTTCATAAGTTCTACCGGGGTAGCGGAGGCAGTTTCAGCAAGGCTCAGGA
GGAATGGACCACTGGAGCGTGGAAGAACCCACATGTGCAGCAGGCAGCCCAGAATGCAGCCATGGGGGCT
GCTCAGGGTGCCATGAATCAACCGCAGACTCAGTATTCTGCCACTCCCAACTACACGTACTCCAATGAGA
TGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301635
ORF Size 495 bp
Insert Size 495
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001301635.1, NP_001288564.1
RefSeq Size 3090
RefSeq ORF 495
Locus ID 56807
Gene Summary This gene encodes a member of the Scamp (secretory carrier membrane protein) family. The encoded protein may be involved in neuronal vesicle trafficking. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks an exon in the central coding region, which results in the use of an alternate start codon and a frameshift, compared to variant 1. The encoded isoform (2), has a shorter and distinct N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.