Cdkn2c (NM_001301368) Mouse Untagged Clone

CAT#: MC226039

Cdkn2c (untagged) - Mouse cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (Cdkn2c), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cdkn2c
• Synonyms: C77269; INK4c; p18; p18-INK4c; p18-INK6; p18INK4c
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226039 representing NM_001301368
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCGAGCCTTGGGGGAACGAGTTGGCGTCCGCAGCTGCCAGGGGGGACCTAGAGCAACTTACTAGTT
  TGTTGCAAAATAATGTAAACGTCAACGCTCAAAATGGATTTGGGAGAACTGCGCTGCAGGTTATGAAACT
  TGGAAATCCGGAGATTGCCAGGAGGCTTCTCCTCAGAGGTGCTAATCCCAATTTGAAAGATGGAACTGGT
  TTTGCTGTCATTCATGATGCTGCCAGAGCAGGTTTCCTGGACACTGTACAGGCTTTGCTGGAGTTCCAGG
  CTGATGTTAACATTGAAGATAATGAAGGGAACCTGCCCTTGCACTTGGCTGCCAAAGAAGGCCACCTCCC
  TGTGGTGGAGTTCCTTATGAAGCACACAGCCTGCAATGTGGGGCATCGGAACCATAAGGGGGACACCGCC
  TTCGACTTGGCCAGGTTCTATGGAAGAAATGAGGTCATTAGCCTGATGGAGGCAAATGGGGTTGGGGGAG
  CCACAAGCCTGCAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301368
• ORF Size: 507 bp
• Insert Size: 507
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001301368.1, NP_001288297.1
• RefSeq Size: 2066
• RefSeq ORF: 507
• Locus ID: 12580
• Gene Summary: The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase (cdk) inhibitors, and contains five ankyrin repeats. This protein interacts with both Cdk4 and Cdk6 to inhibit their kinase activities, and prevent their interactions with D-type cyclins, thereby negatively regulating cell division. This gene is differentially expressed in a variety of tissues, and is cell cycle regulated. Deletion of this gene can lead to tumor growth. Maximal expression is observed at the G2/M phase. Alternative splicing and promoter usage results in multiple transript variants. [provided by RefSeq, Aug 2014]
  Transcript Variant: This variant (1, also known as p18(L)) represents the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.