Zfp740 (NM_001289691) Mouse Untagged Clone

CAT#: MC226041

Zfp740 (untagged) - Mouse zinc finger protein 740 (Zfp740), transcript variant 2


  "NM_001289691" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Zfp740"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Zfp740
Synonyms 1110034O07Rik; AW548228; Znf740
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226041 representing NM_001289691
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGCTGAGCCAGATTGCCAGCAAGCAGGCTGAAAACGGCGAGCGGGCAGGTAGCCCTGATGTGCTGA
GGTGCTCCAGTCAGGGCCACCGAAAAGACAGTGATAAATCCCGCAACCGCAAAGAGGATGACAGCTTGGC
TGAGGCCTCTCATTCAAAAAAGACTGTTAAAAAGGTGGTGGTAGTGGAACAAAATGGCTCTTTTCAAGTA
AAGATTCCCAAAAATTTTATTTGTGAACACTGCTTTGGAGCCTTTCGGAGCAGTTACCACCTCAAGAGGC
ACGTCCTAATCCACACTGGTGAGAAACCATTTGAGTGTGATGTCTGTGATATGCGTTTCATCCAGAAGTA
CCATCTCGAACGCCACAAGCGGGTACACAGTGGCGAAAAGCCTTACCAGTGTGAACGATGTCATCAGTGT
TTTTCTCGGACAGACCGATTACTCAGACACAAACGGATGTGCCAAGGATGCCAGTCCAAGACTTCTGAAG
GGCAGTTTTCTCTATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289691
ORF Size 507 bp
Insert Size 507
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001289691.1, NP_001276620.1
RefSeq Size 4249
RefSeq ORF 507
Locus ID 68744
Gene Summary May be involved in transcriptional regulation. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and has multiple differences in the 5' coding region compared to variant 1. These differences cause translation initiation at a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.