Cox4i1 (NM_001293559) Mouse Untagged Clone

CAT#: MC226044

Cox4i1 (untagged) - Mouse cytochrome c oxidase subunit IV isoform 1 (Cox4i1), transcript variant 2


  "NM_001293559" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cox4i1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cox4i1
Synonyms AL024441; COX; Cox4; Cox4a; COXIV; COX IV-1; IV-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226044 representing NM_001293559
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTGGCTTCCAGAGCGCTGAGCCTGATTGGCAAGAGAGCCATTTCTACTTCGGTGTGCCTTCGAGCAC
ATGGGAGTGTTGTGAAGAGTGAAGACTATGCTTTCCCCACTTACGCTGATCGGCGTGACTACCCCTTGCC
TGATGTGGCCCATGTCACGATGCTGTCTGCCAGCCAGAAGGCGCTGAAGGAGAAGGAGAAGGCCGACTGG
AGCAGCCTTTCCAGGGATGAGAAAGTTCAGTTGTACCGCATCCAGTTTAACGAGAGCTTCGCCGAGATGA
ACAGGGGCACCAATGAATGGAAGACAGTTGTGGGCATGGCCATGTTCTTCATTGGCTTCACTGCGCTCGT
TCTGATTTGGGAGAAGAGCTATGTGTATGGCCCCATCCCTCATACTTTCGATCGTGACTGGGTGGCCATG
CAGACCAAGCGAATGCTGGACATGAAGGCCAACCCCATTCAGGGCTTCTCCGCCAAGTGGGACTATGACA
AGAATGAGTGGAAGAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001293559
ORF Size 510 bp
Insert Size 510
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001293559.1, NP_001280488.1
RefSeq Size 687
RefSeq ORF 510
Locus ID 12857
Gene Summary This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded protein (isoform 2) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.