Ctla4 (NM_001281976) Mouse Untagged Clone

CAT#: MC226075

Ctla4 (untagged) - Mouse cytotoxic T-lymphocyte-associated protein 4 (Ctla4), transcript variant 2


  "NM_001281976" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ctla4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ctla4
Synonyms Cd152; Ctla-4; Ly-56
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226075 representing NM_001281976
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTGTCTTGGACTCCGGAGGTACAAAGCTCAACTGCAGCTGCCTTCTAGGACTTGGCCTTTTGTAG
CCCTGCTCACTCTTCTTTTCATCCCAGTCTTCTCTGAAGCCATACAGGTGACCCAACCTTCAGTGGTGTT
GGCTAGCAGCCATGGTGTCGCCAGCTTTCCATGTGAATATTCACCATCACACAACACTGATGAGGTCCGG
GTGACTGTGCTGCGGCAGACAAATGACCAAATGACTGAGGTCTGTGCCACGACATTCACAGAGAAGAATA
CAGTGGGCTTCCTAGATTACCCCTTCTGCAGTGGTACCTTTAATGAAAGCAGAGTGAACCTCACCATCCA
AGGACTGAGAGCTGTTGACACGGGACTGTACCTCTGCAAGGTGGAACTCATGTACCCACCGCCATACTTT
GTGGGCATGGGCAACGGGACGCAGATTTATGTCATTGCTAAAGAAAAGAAGTCCTCTTACAACAGGGGTC
TATGTGAAAATGCCCCCAACAGAGCCAGAATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001281976
ORF Size 525 bp
Insert Size 525
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001281976.1, NP_001268905.1
RefSeq Size 1823
RefSeq ORF 525
Locus ID 12477
Gene Summary This gene is a member of the immunoglobulin superfamily, and encodes a protein that functions as a negative regulator of T-cell responses. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2) lacks the penultimate coding exon, which results in a frame-shift and early translation termination compared to variant 1. The resulting shorter isoform (2, also known as sCTLA-4) with a distinct C-terminus, lacks the transmembrane domain and is secreted (PMIDs: 10831323, 23400950).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.