Cryab (NM_001289782) Mouse Untagged Clone

CAT#: MC226080

Cryab (untagged) - Mouse crystallin, alpha B (Cryab), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cryab
• Synonyms: Crya-2; Crya2; HspB5; P23
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226080 representing NM_001289782
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACATCGCCATCCACCACCCCTGGATCCGGCGCCCCTTCTTCCCCTTCCACTCCCCAAGCCGCCTCT
  TCGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGACCTCTTCTCAACAGCCACTTCCCTGAGCCCCTT
  CTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGGATTGACACCGGACTCTCAGAGATGCGTTTG
  GAGAAGGACAGATTCTCTGTGAATCTGGACGTGAAGCACTTCTCTCCGGAGGAACTCAAAGTCAAGGTTC
  TGGGGGACGTGATTGAGGTCCACGGCAAGCACGAAGAACGCCAGGACGAACATGGCTTCATCTCCAGGGA
  GTTCCACAGGAAGTACCGGATCCCAGCCGATGTGGATCCTCTCACCATCACTTCATCCCTGTCATCTGAT
  GGAGTCCTCACTGTGAATGGACCAAGGAAACAGGTGTCTGGCCCTGAGCGCACCATTCCCATCACCCGTG
  AAGAGAAGCCTGCTGTCGCCGCAGCCCCTAAGAAGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289782
• ORF Size: 528 bp
• Insert Size: 528
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001289782.1, NP_001276711.1
• RefSeq Size: 1117
• RefSeq ORF: 528
• Locus ID: 12955
• Gene Summary: This gene encodes a member of the small heat-shock protein (HSP20) family. The encoded protein is a molecular chaperone that protects proteins against thermal denaturation and other stresses. This protein is a component of the eye lens, regulates lens differentiation and functions as a refractive element in the lens. This protein is a negative regulator of inflammation, has anti-apoptotic properties and also plays a role in the formation of muscular tissue. Mice lacking this gene exhibit worse experimental autoimmune encephalomyelitis and inflammation of the central nervous system compared to the wild type. In mouse models, this gene has a critical role in alleviating the pathology of the neurodegenerative Alexander disease. Mutations in the human gene are associated with myofibrillar myopathy 2, fatal infantile hypertonic myofibrillar myopathy, multiple types of cataract and dilated cardiomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
  Transcript Variant: This variant (1) represents the longest transcript. Variants 1 through 4 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.