Cryab (NM_001289784) Mouse Untagged Clone

CAT#: MC226081

Cryab (untagged) - Mouse crystallin, alpha B (Cryab), transcript variant 3


  "NM_001289784" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cryab"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cryab
Synonyms Crya-2; Crya2; HspB5; P23
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226081 representing NM_001289784
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACATCGCCATCCACCACCCCTGGATCCGGCGCCCCTTCTTCCCCTTCCACTCCCCAAGCCGCCTCT
TCGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGACCTCTTCTCAACAGCCACTTCCCTGAGCCCCTT
CTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGGATTGACACCGGACTCTCAGAGATGCGTTTG
GAGAAGGACAGATTCTCTGTGAATCTGGACGTGAAGCACTTCTCTCCGGAGGAACTCAAAGTCAAGGTTC
TGGGGGACGTGATTGAGGTCCACGGCAAGCACGAAGAACGCCAGGACGAACATGGCTTCATCTCCAGGGA
GTTCCACAGGAAGTACCGGATCCCAGCCGATGTGGATCCTCTCACCATCACTTCATCCCTGTCATCTGAT
GGAGTCCTCACTGTGAATGGACCAAGGAAACAGGTGTCTGGCCCTGAGCGCACCATTCCCATCACCCGTG
AAGAGAAGCCTGCTGTCGCCGCAGCCCCTAAGAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289784
ORF Size 528 bp
Insert Size 528
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001289784.1, NP_001276713.1
RefSeq Size 885
RefSeq ORF 528
Locus ID 12955
Gene Summary This gene encodes a member of the small heat-shock protein (HSP20) family. The encoded protein is a molecular chaperone that protects proteins against thermal denaturation and other stresses. This protein is a component of the eye lens, regulates lens differentiation and functions as a refractive element in the lens. This protein is a negative regulator of inflammation, has anti-apoptotic properties and also plays a role in the formation of muscular tissue. Mice lacking this gene exhibit worse experimental autoimmune encephalomyelitis and inflammation of the central nervous system compared to the wild type. In mouse models, this gene has a critical role in alleviating the pathology of the neurodegenerative Alexander disease. Mutations in the human gene are associated with myofibrillar myopathy 2, fatal infantile hypertonic myofibrillar myopathy, multiple types of cataract and dilated cardiomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1 through 4 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.