Apod (NM_001301354) Mouse Untagged Clone

CAT#: MC226167

Apod (untagged) - Mouse apolipoprotein D (Apod), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Apod
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226167 representing NM_001301354
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGTGACCATGCTGATGTTCCTGGCCACGCTGGCGGGTCTCTTCACCACAGCCAAAGGACAAAATTTCC
  ATCTTGGGAAATGCCCGTCTCCTCCTGTGCAAGAGAATTTTGACGTGAAAAAGTATCTTGGAAGATGGTA
  CGAAATTGAGAAGATCCCAGCGAGCTTTGAGAAAGGAAACTGCATTCAAGCCAACTACTCGCTGATGGAG
  AACGGAAACATCGAAGTGCTAAACAAGGAGCTGAGTCCTGATGGAACCATGAACCAAGTAAAGGGTGAAG
  CCAAACAGAGCAACGTCTCAGAGCCAGCCAAGCTGGAAGTCCAGTTCTTCCCGTTGATGCCACCGGCACC
  CTACTGGATCCTGGCCACCGATTATGAAAACTATGCCCTCGTGTACTCCTGCACCACCTTCTTCTGGCTC
  TTCCATGTGGATTTTGTTTGGATTCTTGGAAGAAATCCTTATCTCCCTCCAGAAACAATAACCTACCTAA
  AAGATATCCTTACTTCTAATGGCATCGACATCGAAAAAATGACAACAACAGATCAAGCGAACTGCCCGGA
  CTTCCTGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301354
• ORF Size: 570 bp
• Insert Size: 570
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001301354.1, NP_001288283.1
• RefSeq Size: 2004
• RefSeq ORF: 570
• Locus ID: 11815
• Gene Summary: The protein encoded by this gene is a component of high-density lipoprotein (HDL), but is unique in that it shares greater structural similarity to lipocalin than to other members of the apolipoprotein family, and has a wider tissue expression pattern. The encoded protein is involved in lipid metabolism, and ablation of this gene results in defects in triglyceride metabolism. Elevated levels of this gene product have been observed in multiple tissues of Niemann-Pick disease mouse models, as well as in some tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
  Transcript Variant: This variant (3) lacks an exon in the 5' UTR compared to variant 1. Variants 1, 2, and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.