Sigmar1 (NM_001286539) Mouse Untagged Clone

CAT#: MC226195

Sigmar1 (untagged) - Mouse sigma non-opioid intracellular receptor 1 (Sigmar1), transcript variant 3


  "NM_001286539" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Sigmar1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Sigmar1
Synonyms Oprs1; Sig1R; sigma1R
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226195 representing NM_001286539
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGTGGGCCGCGGGACGGCGGTGGGCATGGATCACCCTGATTCTGACTATTATCGCAGTGCTGATCC
AGGCCGCCTGGTTGTGGCTGGGCACTCAAAACTTCGTCTTCTCTAGAGAAGAAATAGCGCAGCTTGCTCG
ACAGTATGCGGGGCTGGACCATGAGCTTGCCTTCTCTCGGCTGATCGTGGAGCTGCGGAGGCTGCACCCA
GGCCACGTGCTGCCGGATGAGGAGCTGCAGTGGGTATTTGTGAACGCGGGCGGCTGGATGGGCGCCATGT
GTATTCTGCACGCCTCGCTGTCTGAGTACGTGCTGCTCTTCGGCACCGCCCTGGGCTCCCATGGCCATTC
GGGAGAGACAGTTGTACACGGGCCTGGAGAAGCAACGGCTCTGGAGTGGGGACCAAACACGTGGATGGTG
GAGTACGGCCGGGGTGTTATTCCGTCTACCCTGTTCTTTGCACTAGCCGACACTTTCTTCAGCACCCAGG
ACTACCTCACACTCTTCTATACCCTTCGGGCCTATGCCCGGGGCCTCCGGCTTGAGCTTACCACCTACCT
CTTTGGCCAAGACTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286539
ORF Size 579 bp
Insert Size 579
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001286539.1, NP_001273468.1
RefSeq Size 1547
RefSeq ORF 579
Locus ID 18391
Gene Summary This gene encodes a transmembrane protein located in the endoplasmic reticulum. The encoded protein is a receptor that binds several endogenous ligands, including N,N-dimethyltryptamine, progesterone and pregnenolone and a variety of of non-opiate compounds. The encoded protein plays a role in regulating the activity of ion channels, acting as a chaperone and protecting cells from oxidative stress. In humans, this receptor has been associated with Alzheimer's and Parkinson's diseases, stroke and numerous disease conditions such as depression, pain and addiction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (3) lacks an in-frame exon in the coding region compared to variant 1. The encoded protein (isoform 3) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.