Pitpnb (NM_001301644) Mouse Untagged Clone

CAT#: MC226234

Pitpnb (untagged) - Mouse phosphatidylinositol transfer protein, beta (Pitpnb), transcript variant 3


  "NM_001301644" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pitpnb"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pitpnb
Synonyms PI-TP-beta
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226234 representing NM_001301644
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATTGCTCCCGAGGGCTCCCTGGTGTTTCATGAGAAAGCCTGGAATGCCTACCCCTACTGCAGAACAA
TTGTAACGAATGAATACATGAAAGATGACTTCTTCATCAAAATTGAAACATGGCATAAACCTGACTTGGG
AACATTAGAAAATGTTCACGGTTTAGATCCCAACACTTGGAAAACTGTTGAAATTGTCCACATAGACATT
GCAGATCGAAGTCAAGTTGAACCAGCAGACTACAAAGCTGATGAAGACCCTGCATTATTCCATTCAGTCA
AGACCAAGAGAGGACCCCTGGGACCTAACTGGAAGAAGGAGCTGGCAAACACCCCTGACTGTCCTAGGAT
GTGTGCCTATAAGCTGGTGACCATCAAGTTCAAGTGGTGGGGGCTGCAGAGCAAAGTAGAGAACTTTATC
CAGAAGCAAGAAAAACGGATATTTACGAACTTACATCGCCAGCTCTTTTGTTGGATTGACAAGTGGATTG
ACCTGACAATGGAAGACATTAGGCGAATGGAGGATGAGACTCAGAAAGAACTAGAAACAATGCGTAAGAA
GGGTTCCGTCCGAGGCACGTCGGCTGCTGATGCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301644
ORF Size 597 bp
Insert Size 597
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001301644.1, NP_001288573.1
RefSeq Size 2816
RefSeq ORF 597
Locus ID 56305
Gene Summary This gene encodes a member of the phosphatidylinositol transfer protein family. The encoded protein catalyzes the transfer of phospholipids (phosphatidylinositol and phosphatidylcholine) between membranes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (3) has multiple differences, compared to variant 1. These differences result in a distinct 5' UTR, cause translation initiation at a downstream start codon, and result in a distinct 3' coding region and UTR, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.