Mpdu1 (NM_001301710) Mouse Untagged Clone

CAT#: MC226250

Mpdu1 (untagged) - Mouse mannose-P-dolichol utilization defect 1 (Mpdu1), transcript variant 2


  "NM_001301710" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Mpdu1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mpdu1
Synonyms LEC35; SL15; Supl15h
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226250 representing NM_001301710
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGGGGAGGCCGACGGGCCGTTCAAAGGGCTGCTGGTGCCAATTCTTTTACCTGAGAAATGTTACG
ACCAGCTCTTCGTGCAATGGGACTTGCTTCATGTTCCCTGCCTCAAGATTCTCCTCAGCAAAGGCCTCGG
GCTGGGCATCGTGGCTGGGTCACTTCTCGTCAAGCTGCCCCAGGTATTTAAACTCTTGGGAGCCAAGAGT
GCAGAAGGACTGAGTCTCCAGTCAGTAATGCTGGAGCTAGTGGCACTGACCGGAACCGTGGTCTACAGCA
TCACCAACAACTTCCCCTTCAGTTGCTTCAGGCAGCCACTAACTACCGCAACGGACACACAGGCCAGCTT
TCAGCCATTACAGTGTTTATGCTGTTTGGGGGCTCCTTGGCCCGAATCTTCACTTCTGTTCAGGAAACTG
GAGACCCCCTCATGGCTGGAGTCTTTGTGGTCTCTTCTCTCTGCAATGGCCTCATTGCTGCCCAGGTCCT
CTTCTACTGGAACGCAAAGGCTCCCCACAAACAGAAAAAGGAGCAATAGAGCTGAGCTCGCTTCTAGAAC
AATTCCATTTCCACTCATCCTCAGAGTCCTCCCCACATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301710
ORF Size 600 bp
Insert Size 600
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001301710.1, NP_001288639.1
RefSeq Size 1123
RefSeq ORF 600
Locus ID 24070
Gene Summary This gene encodes a member of the PQ-loop superfamily. A similar gene in human encodes a protein that is required for monosaccharide-P-dolichol-dependent glycosyltransferase reactions, and disruption of this gene is the cause of congenital disorder of glycosylation (CDG) type 1F, a disease linked to defects in protein N-glycosylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (2) lacks two alternate exons which results in a frameshift in the 3' coding region compared to variant 1. The resulting protein (isoform 2) has a distinct C-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.