Prdx6 (NM_001303408) Mouse Untagged Clone

CAT#: MC226261

Prdx6 (untagged) - Mouse peroxiredoxin 6 (Prdx6), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Prdx6
• Synonyms: 1-Cys Prx; 1-cysPrx; 9430088D19Rik; AA690119; aiPLA2; Aop2; Brp-12; CP-3; GPx; Ltw-4; Ltw4; Lvtw-4; NSGPx; ORF06; Prdx5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226261 representing NM_001303408
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGTGGCATCTTAAGATGAGATGGGGCATTCTCTTTTCCCACCCACGGGACTTTACCCCAGTGTGCA
  CCACAGAACTTGGCAGAGCTGCAAAGCTGGCGCCAGAGTTTGCCAAGAGGAATGTTAAGTTGATTGCTCT
  TTCAATAGACAGTGTTGAGGATCATCTTGCCTGGAGCAAGGACATCAATGCTTACAATGGTGAAACACCC
  ACGGAAAAGTTGCCATTTCCCATCATTGATGATAAGGGCAGGGACCTTGCCATCCTTTTGGGCATGTTGG
  ATCCAGTCGAGAAGGACGCTAACAACATGCCTGTGACGGCCCGTGTGGTGTTCATTTTTGGCCCTGACAA
  GAAACTGAAGCTGTCTATCCTCTACCCTGCCACCACGGGCAGGAACTTTGATGAGATTCTCAGAGTGGTT
  GACTCTCTCCAGCTGACAGGCACAAAGCCGGTTGCCACCCCAGTTGACTGGAAGAAGGGAGAGAGCGTGA
  TGGTAGTTCCCACCCTCTCCGAAGAGGAAGCCAAACAATGTTTCCCTAAAGGAGTCTTCACCAAAGAGCT
  CCCGTCTGGCAAAAAATACCTCCGTTATACACCCCAGCCTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001303408
• ORF Size: 603 bp
• Insert Size: 603
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001303408.1, NP_001290337.1
• RefSeq Size: 2489
• RefSeq ORF: 603
• Locus ID: 11758
• Gene Summary: This gene encodes a member of the peroxiredoxin family of peroxidases. The encoded protein is a bifunctional enzyme that has glutathione peroxidase and phospholipase activities. This protein is an antioxidant that reduces peroxidized membrane phospholipids and plays an important role in phospholipid homeostasis based on its ability to generate lysophospholipid substrate for the remodeling pathway of phospholipid synthesis. Mice lacking this gene are sensitive to oxidant stress, have altered lung phospholipid metabolism and susceptible to skin tumorigenesis. Alternate splicing of this gene results in multiple transcript variants. A pseudogene of this gene is found on chromosome 4. [provided by RefSeq, Dec 2014]
  Transcript Variant: This variant (2) contains an alternate exon and uses an alternate translation start site, compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.