Crk (NM_001277219) Mouse Untagged Clone

CAT#: MC226285

Crk (untagged) - Mouse v-crk sarcoma virus CT10 oncogene homolog (avian) (Crk), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Crk
• Synonyms: c-Crk; Crk-I; Crk-II; Crk-III; Crk3; CrkIII; Crko; p38
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226285 representing NM_001277219
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGCCGCCTGAGCCGGCAGGAGGCGG
  TGGCGCTATTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCGAGCACCAGCCCCGGGGACTA
  TGTGCTTAGCGTCTCCGAAAACTCGCGCGTCTCCCACTACATCATCAACAGCAGCGGCCCGCGCCCTCCA
  GTGCCTCCGTCGCCCGCTCAGCCTCCGCCGGGAGTGAGTCCCTCCAGGCTCCGAATAGGAGATCAAGAAT
  TTGATTCATTGCCTGCTTTACTGGAATTCTACAAAATACACTATTTGGACACTACAACATTGATAGAACC
  AGTGGCCAGATCAAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCAGAGTATGTGCGGGCCCTC
  TTTGACTTTAATGGGAATGATGAAGAAGATCTTCCCTTTAAGAAAGGAGACATCCTGAGAATCCGGGATA
  AGCCTGAAGAGCAGTGGTGGAATGCAGAGGACAGCGAAGGAAAGAGGGGGATGATTCCTGTCCCTTACGT
  GGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTGATTGGAGGTCGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277219
• ORF Size: 615 bp
• Insert Size: 615
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001277219.1, NP_001264148.1
• RefSeq Size: 5835
• RefSeq ORF: 615
• Locus ID: 12928
• Gene Summary: This gene is part of a family of adapter proteins that mediate formation of signal transduction complexes in response to extracellular stimuli, such as growth and differentiation factors. Protein-protein interactions occur through the SH2 domain, which binds phosphorylated tyrosine residues, and the SH3 domain, which binds proline-rich peptide motifs. These interactions promote recruitment and activation of effector proteins to regulate cell migration, adhesion, and proliferation. In mouse this protein is essential for embryonic development. Alternatively spliced transcripts encoding different isoforms with distinct biological activity have been described. [provided by RefSeq, Mar 2013]
  Transcript Variant: This variant (1) encodes the shorter isoform 1 (also known as CrkI). Isoform 1 (CrkI) contains the SH2 domain and the N-terminal SH3 domain, both of which are proposed to be crucial for development. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.