Hgf (NM_001289460) Mouse Untagged Clone

CAT#: MC226324

Hgf (untagged) - Mouse hepatocyte growth factor (Hgf), transcript variant 4

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hgf
• Synonyms: C230052L06Rik; HGF/SF; NK1; NK2; SF; SF/HGF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226324 representing NM_001289460
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATGTGGGGGACCAAACTTCTGCCGGTCCTGTTGCTGCAGCATGTCCTCCTGCACCTCCTCCTGCTTC
  ATGTCGCCATCCCCTATGCAGAAGGACAGAAGAAAAGAAGAAATACACTTCATGAATTTAAAAAGTCAGC
  AAAAACTACTCTTACCAAGGAAGACCCATTACTGAAGATTAAAACCAAAAAAGTGAACTCTGCAGATGAG
  TGTGCCAACAGGTGTATCAGGAACAGGGGCTTTACGTTCACTTGCAAGGCCTTCGTTTTTGATAAGTCAA
  GAAAACGATGCTACTGGTATCCTTTCAATAGTATGTCAAGTGGAGTGAAAAAAGGGTTTGGCCATGAATT
  TGACCTCTATGAAAACAAAGACTATATTAGAAACTGCATCATTGGTAAAGGAGGCAGCTATAAAGGGACG
  GTATCCATCACTAAGAGTGGCATCAAATGCCAGCCTTGGAATTCCATGATCCCCCATGAACACAGCTTTT
  TGCCTTCGAGCTATCGCGGTAAAGACCTACAGGAAAACTACTGTCGAAATCCTCGAGGGGAAGAAGGGGG
  ACCCTGGTGTTTCACAAGCAATCCAGAGGTACGCTACGAAGTCTGTGACATTCCTCAGTGTTCAGAAGGT
  AAATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289460
• ORF Size: 636 bp
• Insert Size: 636
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001289460.2, NP_001276389.1
• RefSeq Size: 2143
• RefSeq ORF: 636
• Locus ID: 15234
• Gene Summary: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (4) lacks multiple 3' coding exons and its 3' terminal exon extends past a splice site used in variant 1, resulting in a different 3' coding region and 3' UTR. The encoded isoform (2) lacks most of the alpha chain and the entire beta chain, has a distinct C-terminus and is shorter compared to isoform 1.