Tnf (NM_001278601) Mouse Untagged Clone

CAT#: MC226370

Tnf (untagged) - Mouse tumor necrosis factor (Tnf), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tnf
• Synonyms: DIF; TNF-a; TNF-alpha; Tnfa; TNFalpha; Tnfsf1a; TNFSF2; Tnlg1f
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226370 representing NM_001278601
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCACAGAAAGCATGATCCGCGACGTGGAACTGGCAGAAGAGGCACTCCCCCAAAAGATGGGGGGCT
  TCCAGAACTCCAGGCGGTGCCTATGTCTCAGCCTCTTCTCATTCCTGCTTGTGGCAGGGGCCACCACGCT
  CTTCTGTCTACTGAACTTCGGGGTGATCGGTCCCCAAAGGGATGAGAAGTTCCCAAATGGCCTCCCTCTC
  ATCAGTTCTATGGCCCAGACCCTCACACTCACAAACCACCAAGTGGAGGAGCAGCTGGAGTGGCTGAGCC
  AGCGCGCCAACGCCCTCCTGGCCAACGGCATGGATCTCAAAGACAACCAACTAGTGGTGCCAGCCGATGG
  GTTGTACCTTGTCTACTCCCAGGTTCTCTTCAAGGGACAAGGCTGCCCCGACTACGTGCTCCTCACCCAC
  ACCGTCAGCCGATTTGCTATCTCATACCAGGAGAAAGTCAACCTCCTCTCTGCCGTCAAGAGCCCCTGCC
  CCAAGGACACCCCTGAGGGGGCTGAGCTCAAACCCTGGTATGAGCCCATATACCTGGGAGGAGTCTTCCA
  GCTGGAGAAGGGGGACCAACTCAGCGCTGAGGTCAATCTGCCCAAGTACTTAGACTTTGCGGAGTCCGGG
  CAGGTCTACTTTGGAGTCATTGCTCTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278601
• ORF Size: 660 bp
• Insert Size: 660
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001278601.1, NP_001265530.1
• RefSeq Size: 1605
• RefSeq ORF: 660
• Locus ID: 21926
• Gene Summary: This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. Members of this family are classified based on primary sequence, function, and structure. This protein is synthesized as a type-II transmembrane protein and is reported to be cleaved into products that exert distinct biological functions. It plays an important role in the innate immune response as well as regulating homeostasis but is also implicated in diseases of chronic inflammation. In mouse deficiency of this gene is associated with defects in response to bacterial infection, with defects in forming organized follicular dendritic cell networks and germinal centers, and with a lack of primary B cell follicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.