Plpp2 (NM_001302389) Mouse Untagged Clone

CAT#: MC226372

Ppap2c (untagged) - Mouse phosphatidic acid phosphatase type 2C (Ppap2c), transcript variant 2


  "NM_001302389" in other vectors (1)

Reconstitution Protocol

USD 230.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Plpp2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Plpp2
Synonyms Lpp2; PAP2-G; PAP2-gamma; PAP2c; Ppap2c
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226372 representing NM_001302389
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGGGGTCATCATCACAGCTACTGTCATCCTTGTCTCATTGGGAGAAGCCTACCTGGTGTACACAG
ACCGTCTTTATTCGCGATCCAACTTCAACAACTATGTAGCTGCCATCTACAAGGTGCTGGGAACCTTTCT
GTTCGGGGCTGCTGTGAGCCAGTCTCTCACCGACCTGGCCAAGTACATGATTGGCCGTCTTCGACCCAGT
TTCTTGGCTGTCTGTGACCCTGACTGGAGCCAGGTCAACTGTTCTGGCTATGTGCAGCTGGAGGTGTGCA
GGGGCAGCCCTGCTAATGTCACGGAGGCCAGGCTGTCCTTCTACTCTGGCCACTCCTCCTTTGGCATGTA
TTGCATGTTGTTCCTGGCGCTATATGTGCAGGCCCGGCTCTGCTGGAAGTGGGCACGGCTGCTGAGGCCC
ACTGTTCAGTTCTTCTTGGTGGCCTTTGCAATCTATGTGGGCTATACCCGAGTGTCTGACCACAAGCACC
ACTGGAGTGATGTCCTTGTCGGCCTCCTGCAGGGAGCCCTGGTGGCCTGCCTCACGGTCCGCTATGTTTC
AGATTTCTTCAAATCCCGGCCACCCCAGCCCTGCCAGGAGGATGAAGTGCCGGAGCGCAAGCCCAGTCTG
TCACTGACGCTGACCCTTGGTGACCGACCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302389
ORF Size 663 bp
Insert Size 663
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001302389.1, NP_001289318.1
RefSeq Size 1610
RefSeq ORF 663
Locus ID 50784
Gene Summary The protein encoded by this gene is a lipid phosphate phosphohydrolase. It is an integral membrane protein that catalyzes the conversion of phosphatidic acid to diacylglycerol and inorganic phosphate. The transcript is expressed at high levels in lung, liver, and kidney and at low levels in brain and heart. Null mutant mice are viable and fertile and display no overt phenotypic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon compared to variant 1. It encodes isoform 2, which has a shorter N-terminus compared to isoform 1. Both variants 2 and 4 encode the same protein (isoform 2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.